QuantSeq raw sequencing reads should be trimmed to remove adapter sequences, poly(A) / poly(T) sequences, and low quality nucleotides. Reads that are too short (i.e., <20 nt) or have generally low quality scores should also be removed prior to alignment.
For adapter trimming, please, use the following sequence:
| Code Block |
|---|
5' – AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC – 3' |
As second strand synthesis is based on random priming, there may be a higher proportion of errors at the first nucleotides of the insert due to non-specific hybridization of the random primer to the cDNA template.
...