Yes, a 6 – 8 nt long molecular index can be introduced between the adapter sequence and target sequence. With molecular indices, PCR duplication events can be distinguished from unique priming events. Also, by using this random sequence, cluster calling can be easily accomplished on Illumina platforms. Illumina platforms rely on the initial rounds of sequencing for cluster calling and an even nucleotide sequence (25 % of A, C, G, and T) is maintained at each of these positions. If these random nucleotides are not included, be sure to design and combine your targeted primers in such a way that the first 5 nts are equally balanced within the final lane mix.
Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:
5' GTTCAGACGTGTGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (= cDNA sequence) 3'
If the molecular index is introduced in the First Strand Synthesis Primer, a paired-end sequencing run is required for read-out.
Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:
5' CACGACGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (mRNA-sequence) 3'
| Anchor |
|---|
| _5._Which_primers |
|---|
| _5._Which_primers |
|---|
|