Please also check this FAQ: Can I use sample barcodes or UMIs for targeted sequencing? if you intend to include UMIs or sample barcodes, or if you are using one or a few target-specific primers at each step.
| Table of Contents |
|---|
First Strand Synthesis
Any primer used for First Strand cDNA Synthesis has to be designed with a partial Illumina P7 adapter extension.
...
| Code Block |
|---|
5' GTTCAGACGTGTGCTCTTCCGATCT – Target sequence 3' |
NOTE: Adapter sequences are kept short pre-PCR to allow for efficient removal of short fragments during the purification steps. The full Illumina P7 (Read 2) adapter sequence will only be introduced during Endpoint PCR.
...
Orientation: The target sequence has to be the reverse complement to the mRNA sequence in question (=cDNA).
Melting Temperature: The chosen target sequence should be as specific as possible with a melting temperature (Tm) that is as close as possible to the intended reaction temperature (50 °C).
Length: In most cases, 20 nucleotides (nts) are enough for the target-specific priming sequence. Please also note:
The optimal primer length is 45 – 50 nts (25 nt Illumina Sequence + 20 – 25 nt targeted sequence).
Target-specific primer sequences should not exceed 50 nts.
The entire primer including the Illumina Adapter sequence should not exceed 75 nts.
NOTE: When using existing qPCR primer pairs for QuantSeq-Flex library prep, the REVERSE qPCR primer should be used for first strand synthesis.
...
| Code Block |
|---|
5' CACGACGCTCTTCCGATCT – Target sequence (mRNA-sequence) 3' |
NOTE: Adapter sequences are kept short pre-PCR to allow for efficient removal of short fragments during the purification steps. The full Illumina P5 (Read 2) adapter sequence will only be introduced during Endpoint PCR.
...
Orientation: The target-specific binding sequence has to be the mRNA-sequence in question.
Melting Temperature: The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature. The Tm of the targeted primers must be between 45 - 72 °C. ATTENTION! temperatures below 45 °C should not be used.
Length: In most cases, 20 nucleotides (nts) are enough for the target-specific priming sequence. Please also note:
The optimal primer length is 39 – 50 nt (19 nt Illumina Sequence + 20 – 31 nt targeted sequence).
Target-specific primer sequences should not exceed 50 nts.
The entire primer including the Illumina Adapter sequence should not exceed 75 nt.
NOTE: Including 1 – 3 phosphorothioate linkages (PTOs) at the 3' end of the target-specific Second Strand Synthesis Primers may increase specificity, but is not required.