Yes.
A 6 – 10 nt long randomized sequence, refered to as a unique molecular index (UMI) can be introduced between the adapter sequence and target sequence of each primer. With molecular indices, PCR duplication events can be distinguished from unique priming events.
...
Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:
| Code Block |
|---|
5' GTTCAGACGTGTGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (= cDNA sequence) 3' |
NOTE: If the molecular index is introduced in the First Strand Synthesis Primer, a paired-end sequencing run is required for read-out.
Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:
| Code Block |
|---|
5' CACGACGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (mRNA-sequence) 3' |
UMIs to control sequencing run quality
...