The protocol is based on QuantSeq FWD strategy which gives all the functionalities needed for the custom library prep, therefore QuantSeq REV does not bring many advantages. Using QuantSeq REV protocol would yield sequences corresponding to cDNA. However, if you would like to have the custom protocol based on QuantSeq REV, please contact support@lexogen.com
QuantSeq-Flex Second Strand Synthesis Module V2 ( Cat. No. 028) can be used in combination with QuantSeq REV (Cat. No. 225). Since first strand synthesis introduces a P5 adaptor, a P7 adaptor needs to be added to the second strand custom oligo as follow:
Partial P7 adapter – (Optional) UMI - Targeted Sequence:
5’GTTCAGACGTGTGCTCTTCCGATCT - (NNNNNN(NN)) - Target Sequence (= RNA-sequence)3’
Here the target sequence has to be the RNA-sequence in question.
NOTE: A longer UMI is recommended, up to 12nt UMI: (NNNNNN(NN(NN)(NN)))
NOTE: If UMIs are added during second strand synthesis, partial PE sequencing will need to be performed to read out the UMI.