Lexogen Online FAQs

What is the adapter sequence I need to use for trimming Read 1?

Owned by Matteo Carina (Unlicensed)
Last updated: Jun 07, 2022 by Stephanie Bannister
1 min read

 

For adapter trimming, please, use the following sequence:

5' – TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC – 3'

Have feedback for us or need more information? Send us a request or write to us at support@lexogen.com.