Can I use QuantSeq-Flex with the QuantSeq REV version?

QuantSeq-Flex Second Strand Synthesis Module V2 ( Cat. No. 028) can be used in combination with QuantSeq REV (Cat. No. 225). Since first strand synthesis introduces a P5 adaptor, a P7 adaptor needs to be added to the second strand custom oligo as follow:

Partial P7 adapter – (Optional) UMI - Targeted Sequence:

5’GTTCAGACGTGTGCTCTTCCGATCT - (NNNNNN(NN)) - Target Sequence (= RNA-sequence)3’

Here the target sequence has to be the RNA-sequence in question.

NOTE: A longer UMI is recommended, up to 12nt UMI: (NNNNNN(NN(NN)(NN)))

NOTE: If UMIs are added during second strand synthesis, partial PE sequencing will need to be performed to read out the UMI.