/
Which sequences are used for PCR amplification?
Lexogen Online FAQs
Which sequences are used for PCR amplification?
- Matteo Carina (Unlicensed)
- Stephanie Bannister
- Alex Mojcher (Unlicensed)
Owned by Matteo Carina (Unlicensed)
Last updated: Nov 24, 2021 by Stephanie Bannister
The sequences of the PCR primers included in the TeloPrime Kit are outlined in Appendix D of the TeloPrime V2 User Guide, and below:
FP: 5’ – TGGATTGATATGTAATACGACTCACTATAG – 3‘
RP: 5’ – TCTCAGGCGTTTTTTTTTTTTTTTTTT – 3‘
Related content
How many PCR cycles should I use to amplify my libraries?
How many PCR cycles should I use to amplify my libraries?
More like this
PCR Add-on and Reamplification Kit V2
PCR Add-on and Reamplification Kit V2
More like this
Which library prep kits are compatible with the new PCR Add-on and Reamplification Kit V2?
Which library prep kits are compatible with the new PCR Add-on and Reamplification Kit V2?
More like this
How is the cycle number of the endpoint PCR determined?
How is the cycle number of the endpoint PCR determined?
More like this
Can I use custom primers for reverse transcription or PCR?
Can I use custom primers for reverse transcription or PCR?
More like this
What are the input RNA requirements for TeloPrime?
What are the input RNA requirements for TeloPrime?
More like this
Have feedback for us or need more information? Send us a request or write to us at support@lexogen.com.